circad | circRNAs associated with diseases

circRNA5430
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Lung Adenocarcinoma	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	31626137
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Five paired LA and normal participants
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCATTTCCCAACAGATTACCC Reverse GCTTGCCAATGGAACACT	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Mu, Y, Xie, F, Huang, Y, Yang, D, Xu, G, Wang, C, Wu, Q (2019). Circular RNA expression profile in peripheral whole blood of lung adenocarcinoma by high: Throughput sequencing. Medicine (Baltimore), 98, 42:e17601.